biogenist_top_1




A Scientific Approach To Biotechnology

biogenist_Banner_under_links
A Scientific approch to biotechnology between_pic_1 Biotechnology between_pic_2 Biotechnology Help
biogenist_divider_hor
 

Understanding Biotechnology


What is Biotechnology

Overview of Biotechnology

  Then and Now of Biotechnology
 

History of Biotechnology

  Gene Technology
  What is a gene
  Gene Technology Techniques
  Genetic modification myths
  Genes code for proteins
  What is DNA
  Where is DNA
  The Full Set
  What does DNA look like
  What does DNA work
  DNA Unknown

Why do we do biotechnology?


  Why do we do biotechnology?
  Biotechnology for ourselves

Biotechnology for the environment

Biotechnology for food and agriculture

How do you do biotechnology?

  How do you do biotechnology
Finding the gene you want
  Cutting and pasting genes
  Moving genes
  Reading and interpreting genes
  Cloning a gene
  Cloning plants
  Cloning animals
Biotechnology Applications

  Human Uses
  Fighting infectious diseases
  Antibiotics
  Producing human products
  Reproductive technologies
  The human genome project
  Genetic disorders
  Gene therapy
  Cloning
  Stem cells
  Transplantation
  DNA profiling
  Environment
  Biological control of pests
  Protecting threatened species
  Resurrecting extinct species
  Cleaning up and managing
  Researching new products
  Food and Agriculture
  Feed Me
  A problem with weeds
  A problem with insects
  Other reasons to modify crops
  The international scene
  Genetically modified food labeling
  Health and Medical
  Biotechnology in medicines
  Clinical trials
  Gene therapy
  Genes and cancer
  What are ethics
Benefits & Risks of Biotechnology

  Arguments for and against gene
  A nutritionist's view on GM foods
  Balance sheet 2020
  Sustaining the Food supply
Biotechnology Resources

  Ethics of biotechnology
  Conferences and events
  Forums and Communities
  Biotechnology Websites
  Glossary of terms
   
 
 

 

  Bookmark and Share

 

DNA Profiling

  Each of us has a unique DNA profile or fingerprint. A technique called electrophoresis is used to obtain DNA profiles, relying on sections of our DNA that are known as non-coding DNA (DNA that does not code for a protein).

We have many sections of non-coding DNA in our genome. Within this non-coding DNA are areas called short tandem repeats (STRs). For example, you may have a stretch of DNA made up of the following base sequence:

ATCTTCTAACACATGACCGATCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGTTCCATGATAGCACAT

This sequence starts off looking random, but then has repeats of the sequence CATG towards the middle. It becomes random again near the end. The repetitive section of the sequence is what is referred to as an STR.

For a given STR, you will have inherited different numbers of the repeated sequence from each of your parents. For example, you may have inherited 11 repeats of the CATG sequence, as shown above, on a chromosome from your mother, and 3 repeats of this sequence within the STR on the matching chromosome from your father.

The different numbers of repeats within an STR results in DNA of different lengths. Because of this, electrophoresis can be used to show how many repeats you have.

Generating a DNA profile usually involves analysing an individual's DNA for ten different STRs on different chromosomes. Statistically, no two people (except identical twins) are likely to have the same numbers of repeats in all of these STRs.

Polymerase chain reaction (PCR) is used to produce many copies of the ten STRs before they are later analysed using electrophoresis. The different lengths of DNA will show up as bands at different spots on the electrophoresis gel (see picture above). The banding pattern produced is called a DNA profile or fingerprint, and can be analysed.

 
 

DNA profiles for forensic use

  Each of the chromosomes in your cells contains sections of non-coding DNA — DNA that does not code for a protein. Non-coding DNA contains areas called short tandem repeats (STRs), made up of repeats of short base sequences, such as CATG in the sequence CATGCATGCATG.

If the DNA of two people was analysed for 10 different STRs on different chromosomes, there is only one chance in a million that they would have the same number of repeats in all of these STRs. Identical twins are the only exception — they have identical DNA and identical STRs.

If a crime suspect's DNA profile for 10 STRs matches the STR profile of a sample found at the crime scene, there is a very high probability that both lots of DNA are from the same person. However, if the profiles differ for even one STR, this cannot be assumed.

DNA is used as evidence in court, but it is considered ‘circumstantial' evidence, and can only be used as proof with other supporting evidence. However, it has proven useful in establishing the innocence of suspects.

As seen on TV

Just like our favourite forensic science TV dramas, forensic scientists can help solve crimes by analysing DNA samples from crime scenes and comparing them to DNA samples from victims and suspects.

However, in reality, forensic techniques are a bit more complicated and take much longer than the ten minutes seen on TV — more like two weeks, in fact. And, in a real forensic investigation, specialists would be performing specific tasks, rather than one person doing everything.

Lawyers and forensic scientists have noted that many people have a distorted view of how forensic science is really used in criminal cases, and believe that all forensic evidence is infallible.

 
 

DNA testing of prison inmates

  A number of crimes remain unsolved due to lack of evidence. The majority of crimes are committed by only a few people. Of these few, there are a number of repeat offenders. The United States , England and New Zealand have central DNA databases containing the profiles of all previously convicted people. This allows for a quick identification if they reoffend.

Australia's CrimTrac central database is also likely to help solve some unsolved crimes. At the moment, the states and territories have different laws regarding access to DNA profiles of suspects or charged persons. This issue has a concerns surrounding it, such as whether taking DNA samples from prison inmates is a breach of legal rights.

 
 

Disaster victim identification

  It is often difficult to identify victims after disasters such as bombing or fires. Forensic scientists are called in to identify the DNA obtained from body parts or teeth.

During the aftermath of the 2002 Bali bombing, relatives of victims were asked to arrange collection of DNA samples from personal items such as toothbrushes or combs. So far, of the 221 missing or deceased in Bali , 182 have been identified, including 88 Australians. DNA profiling identified 115 people, while fingerprints, dental records and medical records were also used to identify victims.

Australian forensic experts went to Thailand to assist with the identification of bodies following the 2004 tsunami

 
 

DNA profiles can reveal family relationships

  DNA samples can be analysed to explore possible paternal and maternal relationships between parents and children. This is possible because half of each person's 23 pairs of chromosomes come from their mother, and half from their father.

Each of the chromosomes contains many sections of non-coding DNA that does not seem to code for a protein, but contains areas called short tandem repeats (STRs). Each STR contains repeats of short sequences of bases, such as CATG in CATGCATGCATG.

When STRs are tested in DNA profiling, they occur in pairs. One chromosome in a pair carries an STR from the person's mother, and the other carries an STR from the person’s father.

A person’s DNA profile as seen on an electrophoresis gel usually shows two lines for each of the STRs tested. This is because usually, the STRs inherited from the parents are of different lengths. Occasionally, only one line appears because both STRs in a pair are of the same length.

When the DNA profile of a child is compared to the profiles of the child's genetic parents, it is possible to match one line in each STR area with a line in that area of the mother's profile. In this way, DNA profiling can also reveal non-paternity.

Three or four STRs, of very different sizes, are analysed when exploring family relationships.

DNA profiling in the media

Elizabeth Hurley, the British actor and cosmetics spokesperson, went to court to prove who the father of her baby was. The case was brought to the family court by her ex-boyfriend, Hollywood producer Stephen Bing.

DNA testing proved that Bing was indeed the father. This news came at a rather unfortunate moment, as Bing was waiting for results from a DNA test relating to another paternity case with a different person.

   
 
   
biogenist_Bottom